Review



aav9 chemicals  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc aav9 chemicals
    Aav9 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 86 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/pm41860867-130-67-64
    Average 95 stars, based on 86 article reviews
    aav9 chemicals - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Bioprocessing:

    Article Title: Shank3 modulates Rpl3 expression and protein synthesis via mGlu5: implications for Phelan McDermid syndrome
    Article Snippet: Cells lysate was quantified by BCA protein assay (EuroClone) to assess protein concentration and then solubilized in 4×loading dye (250 mM Tris–HCl pH 6.8, 40% glycerol, 0.008% bromophenol blue, 8% SDS; all from Sigma- Aldrich). .. Stereotaxic injections of pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene, 105540-AAV9), AAV9-CMV-m-RPL3 (Vector Biolabs, AAV-270914) or, pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (AAV9-CMV-GFP-Cre) (Addgene viral prep, 105545-AAV9), were performed bilaterally into prefrontal Cortex (coordinates: bregma: 0.0 mm; anterior-posterior: 2.2 mm; dorso-ventral: 1.5 mm; medio-lateral: +/− 0.4 mm), striatum (coordinates: bregma: 0.0 mm; anterior-posterior: 0.7 mm; dorso-ventral: 3 mm; medio-lateral: +/− 1.8 mm) and hippocampus (coordinates: bregma: 0.0 mm; anterior-posterior: -1.88 mm; dorsal-ventral: 1.4 mm; medio-lateral: +/− 1.8 mm). ..

    Injection:

    Article Title: Shank3 modulates Rpl3 expression and protein synthesis via mGlu5: implications for Phelan McDermid syndrome.
    Article Snippet: Cells lysate was quantified by BCA protein assay (EuroClone) to assess protein concentration and then solubilized in 4×loading dye (250mM Tris–HCl pH 6.8, 40% glycerol, 0.008% bromophenol blue, 8% SDS; all from Sigma- Aldrich). .. Stereotaxic injection and viral construct Stereotaxic injections of pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene, 105540-AAV9), AAV9-CMV-m-RPL3 (Vector Biolabs, AAV270914) or, pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (AAV9-CMV-GFP-Cre) (Addgene viral prep, 105545-AAV9), were performed bilaterally into prefrontal Cortex (coordinates: bregma: 0.0 mm; anterior-posterior: 2.2 mm; dorso-ventral: 1.5 mm; medio-lateral: +/− 0.4 mm), striatum (coordinates: bregma: 0.0 mm; anterior-posterior: 0.7 mm; dorso-ventral: 3 mm; medio-lateral: +/− 1.8 mm) and hippocampus (coordinates: bregma: 0.0 mm; anterior-posterior: -1.88 mm; dorsal-ventral: 1.4 mm; medio-lateral: +/− 1.8 mm). ..

    Construct:

    Article Title: Shank3 modulates Rpl3 expression and protein synthesis via mGlu5: implications for Phelan McDermid syndrome.
    Article Snippet: Cells lysate was quantified by BCA protein assay (EuroClone) to assess protein concentration and then solubilized in 4×loading dye (250mM Tris–HCl pH 6.8, 40% glycerol, 0.008% bromophenol blue, 8% SDS; all from Sigma- Aldrich). .. Stereotaxic injection and viral construct Stereotaxic injections of pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene, 105540-AAV9), AAV9-CMV-m-RPL3 (Vector Biolabs, AAV270914) or, pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (AAV9-CMV-GFP-Cre) (Addgene viral prep, 105545-AAV9), were performed bilaterally into prefrontal Cortex (coordinates: bregma: 0.0 mm; anterior-posterior: 2.2 mm; dorso-ventral: 1.5 mm; medio-lateral: +/− 0.4 mm), striatum (coordinates: bregma: 0.0 mm; anterior-posterior: 0.7 mm; dorso-ventral: 3 mm; medio-lateral: +/− 1.8 mm) and hippocampus (coordinates: bregma: 0.0 mm; anterior-posterior: -1.88 mm; dorsal-ventral: 1.4 mm; medio-lateral: +/− 1.8 mm). ..

    Article Title: The endocytic adaptor AP-2 maintains Purkinje cell function by balancing cerebellar parallel and climbing fiber synapses.
    Article Snippet: Samples were loaded onto a precolumn (Acclaim 5mm PepMap 300 mm Cartridge) for 2 min at 15 ml flow before being reverse flushed onto an in-house packed analytical column (30 cm length, 75 mm inner diameter, filled with 2.7 mm Poroshell EC120 C18, Agilent). .. A P2A-Cre construct was generated from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson, Addgene plasmid # 105545; http://n2t.net/addgene:105545; RRID:Addgene_105545) by site directed mutagenesis using forward (GGCGACG TGGAGGAGAACCCCGGCCCCGCCGGCAGCATGTCCGGAGAGCAAAAGCTG) and reverse (TCTCCTCCACGTCGCCGGCCT GCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCCTTGTACAGCTCGTCCATGC) primers. .. Subsequently, pAAV/L7-6-EGFPP2A-Cre-WPRE was generated using NEBuilder HiFi DNA Assembly.

    Plasmid Preparation:

    Article Title: CO 2 sensitive connexin channel synapses in the VTA release 5HT to regulate dopaminergic neurons
    Article Snippet: .. pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 was a gift from James M. Wilson (Addgene plasmid # 105545; http://n2t.net/addgene:105545 ; RRID:Addgene_105545) and pAAV-hSyn-DIO-mCherry was a gift from Bryan Roth (Addgene plasmid # 50459; http://n2t.net/addgene:50459 ; RRID:Addgene_50459). ..

    Article Title: The endocytic adaptor AP-2 maintains Purkinje cell function by balancing cerebellar parallel and climbing fiber synapses.
    Article Snippet: Samples were loaded onto a precolumn (Acclaim 5mm PepMap 300 mm Cartridge) for 2 min at 15 ml flow before being reverse flushed onto an in-house packed analytical column (30 cm length, 75 mm inner diameter, filled with 2.7 mm Poroshell EC120 C18, Agilent). .. A P2A-Cre construct was generated from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson, Addgene plasmid # 105545; http://n2t.net/addgene:105545; RRID:Addgene_105545) by site directed mutagenesis using forward (GGCGACG TGGAGGAGAACCCCGGCCCCGCCGGCAGCATGTCCGGAGAGCAAAAGCTG) and reverse (TCTCCTCCACGTCGCCGGCCT GCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCCTTGTACAGCTCGTCCATGC) primers. .. Subsequently, pAAV/L7-6-EGFPP2A-Cre-WPRE was generated using NEBuilder HiFi DNA Assembly.

    Article Title: Gephyrin filaments represent the molecular basis of inhibitory postsynaptic densities.
    Article Snippet: .. First, pAAV-CamKIIa-moxBFP-Cre was generated by subcloning Cre from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson (Addgene plasmid # 105545; RRID:Addgene_105545)) into pAAV-CamKIIa-moxBFP-WPRE (Addgene plasmid # 194976; RRID:Addgene_194976). ..

    Generated:

    Article Title: The endocytic adaptor AP-2 maintains Purkinje cell function by balancing cerebellar parallel and climbing fiber synapses.
    Article Snippet: Samples were loaded onto a precolumn (Acclaim 5mm PepMap 300 mm Cartridge) for 2 min at 15 ml flow before being reverse flushed onto an in-house packed analytical column (30 cm length, 75 mm inner diameter, filled with 2.7 mm Poroshell EC120 C18, Agilent). .. A P2A-Cre construct was generated from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson, Addgene plasmid # 105545; http://n2t.net/addgene:105545; RRID:Addgene_105545) by site directed mutagenesis using forward (GGCGACG TGGAGGAGAACCCCGGCCCCGCCGGCAGCATGTCCGGAGAGCAAAAGCTG) and reverse (TCTCCTCCACGTCGCCGGCCT GCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCCTTGTACAGCTCGTCCATGC) primers. .. Subsequently, pAAV/L7-6-EGFPP2A-Cre-WPRE was generated using NEBuilder HiFi DNA Assembly.

    Article Title: Gephyrin filaments represent the molecular basis of inhibitory postsynaptic densities.
    Article Snippet: .. First, pAAV-CamKIIa-moxBFP-Cre was generated by subcloning Cre from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson (Addgene plasmid # 105545; RRID:Addgene_105545)) into pAAV-CamKIIa-moxBFP-WPRE (Addgene plasmid # 194976; RRID:Addgene_194976). ..

    Mutagenesis:

    Article Title: The endocytic adaptor AP-2 maintains Purkinje cell function by balancing cerebellar parallel and climbing fiber synapses.
    Article Snippet: Samples were loaded onto a precolumn (Acclaim 5mm PepMap 300 mm Cartridge) for 2 min at 15 ml flow before being reverse flushed onto an in-house packed analytical column (30 cm length, 75 mm inner diameter, filled with 2.7 mm Poroshell EC120 C18, Agilent). .. A P2A-Cre construct was generated from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson, Addgene plasmid # 105545; http://n2t.net/addgene:105545; RRID:Addgene_105545) by site directed mutagenesis using forward (GGCGACG TGGAGGAGAACCCCGGCCCCGCCGGCAGCATGTCCGGAGAGCAAAAGCTG) and reverse (TCTCCTCCACGTCGCCGGCCT GCTTCAGCAGGCTGAAGTTGGTGGCGCCGCTGCCCTTGTACAGCTCGTCCATGC) primers. .. Subsequently, pAAV/L7-6-EGFPP2A-Cre-WPRE was generated using NEBuilder HiFi DNA Assembly.

    Subcloning:

    Article Title: Gephyrin filaments represent the molecular basis of inhibitory postsynaptic densities.
    Article Snippet: .. First, pAAV-CamKIIa-moxBFP-Cre was generated by subcloning Cre from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (a gift from James M. Wilson (Addgene plasmid # 105545; RRID:Addgene_105545)) into pAAV-CamKIIa-moxBFP-WPRE (Addgene plasmid # 194976; RRID:Addgene_194976). ..



    Similar Products

    95
    Addgene inc aav9 chemicals
    Aav9 Chemicals, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/pm41860867-130-67-64
    Average 95 stars, based on 1 article reviews
    aav9 chemicals - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc paav cmv hi egfp cre wpre sv40
    Paav Cmv Hi Egfp Cre Wpre Sv40, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/bio_rxiv__64898__2026__03__04__708749-256-1-9
    Average 95 stars, based on 1 article reviews
    paav cmv hi egfp cre wpre sv40 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc james m wilson
    James M Wilson, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/bio_rxiv__64898__2026__03__04__708749-256-6-9
    Average 95 stars, based on 1 article reviews
    james m wilson - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc james m wilson 162
    James M Wilson 162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/10__1523_slash_jneurosci__1692___25__2026-72-5-9
    Average 95 stars, based on 1 article reviews
    james m wilson 162 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc aav5 cmv cre egfp
    Aav5 Cmv Cre Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/bio_rxiv__2025__11__14__688290-288-2-3
    Average 95 stars, based on 1 article reviews
    aav5 cmv cre egfp - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc aav2 cmv egfp cre
    Aav2 Cmv Egfp Cre, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/pm41162376-448-8-9
    Average 95 stars, based on 1 article reviews
    aav2 cmv egfp cre - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Addgene inc aav2
    Aav2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paav+cmv+hi+egfp+cre+wpre+sv40/pAAV%2ECMV%2EHI%2EeGFP-Cre%2EWPRE%2ESV40+(Plasmid+%23105545)/pm41125886-646-0-3
    Average 95 stars, based on 1 article reviews
    aav2 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results